Sage Church
Abstract
Yeast’s are present in a number of environments, however in many locations the specific species or concentrations have not been thoroughly studied. In this study it is being asked if yeasts are present in two separate water sources near Farmville,Virginia, and if so which source will contain a greater amount of yeasts. It is expected that the water sample from the Duck Pond will contain more yeasts because it is a very slow moving water source compared to the other sample from Gross Creek.
Introduction
Yeasts are unicellular organisms related to bacteria that can be found in nearly any temperate environment. They are a highly versatile and diverse category of organisms. They can be found in anything from alcohols, breads, and fruits, to water and soil. When it comes to water many large rivers and other freshwater systems have been tested for yeasts, and the genus Rhodoterula has been found in many of them (Montanari, 2018). This study was conducted to determine with species of yeast are present in small local waterways in Farmville, Virginia. Therefore it was hypothesized that if water samples are taken from Gross Creek and the Duck Pond in Farmville, then the samples will contain yeasts of the Rhodoterula genus as found in larger freshwater ecosystems.
Materials and Methods
To isolate the yeast samples they will be divided into several 10 ml aliquots and passed through an 11μm cellulose filter paper to remove fungal mycelium and debris. Then, the sample will be passed through a 0.45μm cellulose acetate membrane. The membranes can then be incubated on a medium mixture of 0.5% yeast extract, 1.0% peptone, 2.0% glucose, and 2.0% agar dissolved in distilled water. After incubation at 12-14 C for up to 14 days, yeast cells from varying colonies will be removed and placed in Erlenmeyer flasks that have 15 ml of yeast nitrogen base plus 0.5% glucose. Once heavy growth appears, the suspension will be streaked on yeast extract, malt extract, and glucose agar. After incubation at room temperature for 1-3 days, the yeast will be identified and/or characterized (Simard & Blackwood, 1971.)
For gene expression of the yeasts from the water samples PCR is performed. First the samples are cultured at room temperature (30 degrees) before they are removed and put into a microcentrifuge tube with 100 μL of deionized water. Chloroform-isoamyl alcohol is then added and the mixture is vortexed for a few seconds. Next they are centrifuged at 4°C, and when this is completed a pellet is removed from the sample for amplification. The yeasts are amplified using 2.5 mM MgCl2, a reaction buffer, 100 µM of deoxynucleoside
triphosphates, 100 pmol of primer, 5 U of Taq DNA polymerase, and 5-10 µl of the DNA sample being tested (Ruiz-Barba, Maldonado, and Jiménez-Díaz, 2005).
Materials and Methods
Collection, Dilution, and Plating of Yeasts
A water sample was taken from each location, Gross Creek and the Duck Pond, using plastic sample tubes. The samples were then diluted to create a stock solution by adding 5 mL of the samples and 45 mL of distilled water to 50 mL tubes. These were mixed and then the pH was taken. This first solution was 10^0 and was used to make the solutions that follow. Three more tubes were labeled 10^1, 10^2, and 10^3 to create the rest of the dilutes. 900 uL of sterile water and 100 uL of 10^0 were added to 10^1. Then 900 uL of sterile water and 100 uL of 10^1 were added to 10^2, and finally 900 uL of sterile water and 100 uL of 10^2 were added to 10^3. All dilutions were made using micropipettes. Next Yeast Extract Peptone Dextrose (YPD) + Antibiotic Plates were labeled for each dilute, and 100 uL of each dilution was micropipetted onto the plate labeled for it. The dilutions were spread on the plates using a spread plate method with a “hockey stick”, and then incubated at room temperature (18°C – 20°C) for two days. After incubation they were moved to the refrigerator (4°C) until streaking.
Morphology
The next steps to the process were streaking yeast growth from each plate onto a new plate. However, before this the samples were observed using a dissecting microscope to determine the shape, margin, elevation, size, texture, appearance, pigmentation, and optical property. The plates for streaking were marked to have six sections, three on each side, and two samples were streaked on each plate. On each side section sone, two, and three were labeled, so each sample was streaked in section one first. The edge of section one was then streaked into section 2, and section 2 into section 3. These plates were then incubated at room temperature.
PCR and Gel Electrophoresis
The next major step was to run a Polymerase Chain Reaction (PCR) on the samples. In order to run a PCR a mix is needed to help extract the Deoxyribonucleic Acid (DNA) in the process of PCR. PCR also requires 200 uL PCR tubes for the mixtures and samples. One part of the PCR mixture is a mixture itself that is made up of 10X TAQ Buffer, 2.5mM dNTP, 25mM MgCl2, 4μM Primer 1, 4μM Primer 2, DNA Template, TAQ DNA Polymerase, and H2O to equal 50 uL of “Master Mix”. Next part of the chosen yeast sample was mixed into 30 uL of water in an autoclaved microcentrifuge tube, in preparation for the PCR mixture as well. The PCR mixture is 100 uL made up of 10 μl of the pre prepared DNA template that was mixed with the 30 uL of water, 10 μl of primer IST4 (4uM), 10 μl primer IST5 (4uM), 20 μl water, and 50 μl Master Mix. The sequences for the primers were as follows:
IST4: 5’ TCCTCCGCTTATTGATATGC 3’
IST5: 5’ GGAAGTAAAAGTCGTAACAAGG 3’
This mixture was used for each sample that a PCR was being run for. While micropipetting a new tip was needed for each component in this process. The first step of PCR is to heat the samples to 95° C for 30 seconds followed by, 30x(95° C for 30 seconds, 55°C for 60 seconds, 68°C for 60 seconds), and finally 72°C for five minutes. It was then stored at 4°C until further use.
Next the DNA fragments from PCR were separated using Gel Electrophoresis. A 1% agarose gel with 1X TAE buffer was used for gel electrophoresis. A small portion of the sample from the PCR is then loaded into this. A loading buffer was needed to keep the sample sin the gel. The loading buffer was made up of 5uL of water and 2 uL of loading buffer. Next 3 uL of the PCR mixture are added to the loading buffer, which is then pipetted into a well of the gel. However, the gell must first be covered by a TAE buffer. Next the gel was covered with the lid and plugged into the power supply. The gel should be set at 120 V for 30 minutes.
Amplicon Purification
For each PCR label a 1.5 mL tube and add 450 uL of the binding buffer to the tube. Then add 90 uL of the PCR sample to the tube and buffer. These were mixed in a labeled spin filter column where they were then centrifuged for one minute at 13,000 rpm. The filter allowed the DNA to stay while the buffer fell into the tube and was discarded. After the addition of 200 uL of a DNA wash buffer the samples were centrifuged again, and the buffer was discarded again. This step was repeated once more after that. After this a 1.7 mL centrifuge tube was used to transfer the spin filter column to. 30 uL of elution buffer were added and the sample was centrifuged again, but this time what went threw the filter was the desired DNA. This DNA was measured using a nanodrop (ng/uL). After the nanodrop a sample of the DNA is sent into EuroFinsGenomics for sequencing.
Biochemical Assays
The last tests done to the yeast samples were the Temperature Sensitive, Salt Resistance, and Amylase Assays. For these three tests the samples were streaked onto plates again, but this time each plate had a different variable. For the temperature Sensitive Assay the plates were stored at 23℃, 30℃, and 37℃ after streaking. The plate at 23℃, or room temperature, served as a control for all three assays. Then two plates with NaCl supplements of .5 M and 1.5 M were streaked as well. For the last assay a plate with soluble starch was used in order to detect amylase.
Results
It was found that there is yeast present in the local waterways around Farmville, Virginia, in the form of Pichia fermentans. The genome of the yeast grown from these samples was a nearly perfect match to the genome of Pichia fermentans
| Species | % Identity |
| Pichia fermentans
Strain Pferm 62 |
95.85 |
| Pichia fermentans
Culture CBS:4611 |
95.60 |
| Pichia fermentans
Culture CBS:1876 |
96.54 |
| Pichia fermentans
Culture CBS: 2057 |
96.54 |
| Pichia fermentans
Culture CBS:4807 |
96.54 |
Table 1. The top five species hits when the sample FASTA was run through BLAST analysis.
Figure 3. Alignment of sample FASTA and the most similar retrieved fungi (Pichia fermentans) FASTA sequences.
Discussion
In conclusion, the hypothesis was rejected because the yeast found in the samples was not of the genus, Rhodoterula. The yeast that was found, Pichia fermentans, was rather interesting because it is normally found in fermentation reactions. Therefore, the fact that it is present in these samples could be very significant. The Duck Pond is known to be a very polluted and sluggish water source, so the presence of a yeast that ferments things could mean that this yeast is helping to keep the Duck Pond clean. This yeast could be an environmental indicator to the health of a water source due to these facts. Further research should be done to determine the health of the Duck Pond and other water sources, and how the levels of Pichia in each varies based on their health.
References
- Montanari, L. et al. 2018. Yeast isolation and identification in water used in a Brazilian hemodialysis unit by classic microbiological techniques and Raman spectroscopy. Journal of Water and Health, 16(2): 311-320.
- Simard, R., and Blackwood, A. 1971. Yeasts from the St. Lawrence River. Canadian Journal of Microbiology, 17(2): 197-203.
- Sláviková, E., and Vadkertiová, R. 1996. Seasonal Occurrence of Yeasts and Yeast-like Organisms in the River Danube. Slovak Academy of Sciences, 72: 77-80.
- Ahearn, D., Roth, F., and Meyers, S. 1968. Ecology and Characterization of yeasts from Aquatic Regions of South Florida. Marine Biology, 291-308.
- Pathan, A., Bhadra, B., Begum, Z., and Shivaji, S. 2009. Diversity of Yeasts from Puddles in the Vicinity of MidreLove ́nbreen Glacier, Arctic and Bioprospecting for Enzymes and Fatty Acids. Current Microbiology, 60: 307-314.
Ruiz-Barba, J., Maldonado, A., and Jiménez-Díaz, R. 2005. Small-Scale Total DNA Extraction from Bacteria and Yeasts for PCR Applications. Consejo Superior de
Investigaciones Científicas, 1-11.